Problem Set 12 (Hartwell, Chapter 14)

Copy and save these questions to a text file or Word document. Use your initials and the number of the problem set when you save the file. Put your name on the question page. Put your answer to each question right after the question. For questions from Hartwell, it is not necessary to retype the question.

1. Do Hartwell #14.2

2. The following sequence comes from a library clone of E.coli K12. Use the BLAST link from the Genetics Home Page to locate this sequence. What did you find out? What does it suggest about bacterial species? gcagatttgccgctgcccgatacgcccatcaagacgtaaatgtggtgatcatggttagtc

3. Do Hartwell #14.10.

4. Do Hartwell #14.14.

5. Do Hartwell #14.18.